How to find reading frame of mRNA

In molecular biology, a reading frame is a way of dividing the sequence of nucleotides in a nucleic acid (DNA or RNA) molecule into a set of consecutive, non-overlapping triplets. Where these triplets equate to amino acids or stop signals during translation, they are called codons. A single strand of a nucleic acid molecule has a phosphoryl end, called the 5′-end, and a hydroxyl or 3′-end. These define the 5′→3′ direction. There are three reading frames that can be read in this 5′→3′ direction, each beginning from a different nucleotide in a triplet. In a double stranded nucleic acid, an additional three reading frames may be read from the other, complementary strand in the 5′→3′ direction along this strand. As the two strands of a double-stranded nucleic acid molecule are antiparallel, the 5′→3′ direction on the second strand corresponds to the 3′→5′ direction along the first strand. In general, at the most, one reading frame in a given section of a nucleic acid, is biologically relevant (open reading frame). Some viral transcripts can be translated using multiple, overlapping reading frames. There is one known example of overlapping reading frames in mammalian mitochondrial DNA: coding portions of genes for 2 subunits of ATPase overlap. DNA encodes protein sequence by a series of three-nucleotide codons. Any given sequence of DNA can therefore be read in six different ways: Three reading frames in one direction (starting at different nucleotides) and three in the opposite direction. During transcription, the RNA polymerase read the template DNA strand in the 3′→5′ direction, but the mRNA is formed in the 5′ to 3′ direction.[3] The mRNA is single-stranded and therefore only contains three possible reading frames, of which only one is translated. The codons of the mRNA reading frame are translated in the 5′→3′ direction into amino acids by a ribosome to produce a polypeptide chain. Question: If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 5’UCAGGAGGUUAUGGACCAUUGCUGGGACCUUUACAUGCUGUACCAUAGUUCAUGAUAGCCAUG3 #NikolaysGeneticsLessons #mRNA #DNA #codons #Genetics #Proteins #AminoAcids #nucleicAcids #RNA #biology #Transcription #Translation #polypeptide #enzyme #codon #Nucleotide #codonTable #aminoAcid #rybosome #Trna #anticodon #Rrna #TransferRNA #GeneticsFieldOfStudy #stopCodon #startCodon #AnticodonAndCodon #anticodonWooble #anticodonSequence #basePairs #protein #typesOfRNA #codonChart #RNAPolymerase #transcriptionVsTranslation